|
TaKaRa
guide ittm assay Guide Ittm Assay, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/guide ittm assay/product/TaKaRa Average 93 stars, based on 1 article reviews
guide ittm assay - by Bioz Stars,
2026-05
93/100 stars
|
Buy from Supplier |
|
Danaher Inc
alt rtm crispr guide rnas Alt Rtm Crispr Guide Rnas, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/alt rtm crispr guide rnas/product/Danaher Inc Average 92 stars, based on 1 article reviews
alt rtm crispr guide rnas - by Bioz Stars,
2026-05
92/100 stars
|
Buy from Supplier |
|
TaKaRa
crispr cas9 gesicle production system ![]() Crispr Cas9 Gesicle Production System, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/crispr cas9 gesicle production system/product/TaKaRa Average 94 stars, based on 1 article reviews
crispr cas9 gesicle production system - by Bioz Stars,
2026-05
94/100 stars
|
Buy from Supplier |
|
TaKaRa
pguide ![]() Pguide, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pguide/product/TaKaRa Average 95 stars, based on 1 article reviews
pguide - by Bioz Stars,
2026-05
95/100 stars
|
Buy from Supplier |
|
TaKaRa
theguide itcrisprgenomewide sgrna library ngs analysis kit ![]() Theguide Itcrisprgenomewide Sgrna Library Ngs Analysis Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/theguide itcrisprgenomewide sgrna library ngs analysis kit/product/TaKaRa Average 94 stars, based on 1 article reviews
theguide itcrisprgenomewide sgrna library ngs analysis kit - by Bioz Stars,
2026-05
94/100 stars
|
Buy from Supplier |
|
TaKaRa
library pcr kit ![]() Library Pcr Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/library pcr kit/product/TaKaRa Average 93 stars, based on 1 article reviews
library pcr kit - by Bioz Stars,
2026-05
93/100 stars
|
Buy from Supplier |
|
Addgene inc
crispr guide ![]() Crispr Guide, supplied by Addgene inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/crispr guide/product/Addgene inc Average 86 stars, based on 1 article reviews
crispr guide - by Bioz Stars,
2026-05
86/100 stars
|
Buy from Supplier |
|
Benchling Inc
crispr guide rna design tool ![]() Crispr Guide Rna Design Tool, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/crispr guide rna design tool/product/Benchling Inc Average 90 stars, based on 1 article reviews
crispr guide rna design tool - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
Synthego Inc
four different crispr guide rnas ![]() Four Different Crispr Guide Rnas, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/four different crispr guide rnas/product/Synthego Inc Average 90 stars, based on 1 article reviews
four different crispr guide rnas - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
GenScript corporation
rnase1 crispr guide rna (target sequence: tgccaagggctcatgcacga) ![]() Rnase1 Crispr Guide Rna (Target Sequence: Tgccaagggctcatgcacga), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rnase1 crispr guide rna (target sequence: tgccaagggctcatgcacga)/product/GenScript corporation Average 90 stars, based on 1 article reviews
rnase1 crispr guide rna (target sequence: tgccaagggctcatgcacga) - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
Synthego Inc
crispr guide cagucauccgugcgauaugc ![]() Crispr Guide Cagucauccgugcgauaugc, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/crispr guide cagucauccgugcgauaugc/product/Synthego Inc Average 90 stars, based on 1 article reviews
crispr guide cagucauccgugcgauaugc - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
Benchling Inc
guide rnas for crispr–cas9-mediated knockout of carm1 or atg5 ![]() Guide Rnas For Crispr–Cas9 Mediated Knockout Of Carm1 Or Atg5, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/guide rnas for crispr–cas9-mediated knockout of carm1 or atg5/product/Benchling Inc Average 90 stars, based on 1 article reviews
guide rnas for crispr–cas9-mediated knockout of carm1 or atg5 - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Molecular Therapy
Article Title: Gesicle-Mediated Delivery of CRISPR/Cas9 Ribonucleoprotein Complex for Inactivating the HIV Provirus
doi: 10.1016/j.ymthe.2018.10.002
Figure Lengend Snippet: Production and Characterization of Cas9 Gesicles
Article Snippet: Unless otherwise noted, gesicles were prepared using the Guide-it
Techniques:
Journal: Molecular Therapy
Article Title: Gesicle-Mediated Delivery of CRISPR/Cas9 Ribonucleoprotein Complex for Inactivating the HIV Provirus
doi: 10.1016/j.ymthe.2018.10.002
Figure Lengend Snippet: Assaying Gesicle Size and Concentration
Article Snippet: Unless otherwise noted, gesicles were prepared using the Guide-it
Techniques: Concentration Assay
Journal: Molecular Therapy
Article Title: Gesicle-Mediated Delivery of CRISPR/Cas9 Ribonucleoprotein Complex for Inactivating the HIV Provirus
doi: 10.1016/j.ymthe.2018.10.002
Figure Lengend Snippet: Gesicle Treatment Rapidly Delivers Protein to CHME-5 Microglia
Article Snippet: Unless otherwise noted, gesicles were prepared using the Guide-it
Techniques:
Journal: Molecular Therapy
Article Title: Gesicle-Mediated Delivery of CRISPR/Cas9 Ribonucleoprotein Complex for Inactivating the HIV Provirus
doi: 10.1016/j.ymthe.2018.10.002
Figure Lengend Snippet: Schematic of the HIV Long Terminal Repeat and Expected Products after CRISPR/Cas9 Targeting by Gesicles
Article Snippet: Unless otherwise noted, gesicles were prepared using the Guide-it
Techniques: CRISPR
Journal: Molecular Therapy
Article Title: Gesicle-Mediated Delivery of CRISPR/Cas9 Ribonucleoprotein Complex for Inactivating the HIV Provirus
doi: 10.1016/j.ymthe.2018.10.002
Figure Lengend Snippet: Gesicle Treatment Causes Specific Mutation Events at the HIV LTR
Article Snippet: Unless otherwise noted, gesicles were prepared using the Guide-it
Techniques: Mutagenesis
Journal: Molecular Therapy
Article Title: Gesicle-Mediated Delivery of CRISPR/Cas9 Ribonucleoprotein Complex for Inactivating the HIV Provirus
doi: 10.1016/j.ymthe.2018.10.002
Figure Lengend Snippet: Gesicle Treatment Reduces HIV Proviral Activity
Article Snippet: Unless otherwise noted, gesicles were prepared using the Guide-it
Techniques: Activity Assay
Journal: Molecular Therapy
Article Title: Gesicle-Mediated Delivery of CRISPR/Cas9 Ribonucleoprotein Complex for Inactivating the HIV Provirus
doi: 10.1016/j.ymthe.2018.10.002
Figure Lengend Snippet: Gesicle Dosage and Viability
Article Snippet: Unless otherwise noted, gesicles were prepared using the Guide-it
Techniques:
Journal: bioRxiv
Article Title: Microglia ferroptosis is prevalent in neurodegenerative disease and regulated by SEC24B
doi: 10.1101/2021.11.02.466996
Figure Lengend Snippet: (A) Schema for positive selection Genome-wide CRISPR screen in Cas9-expressing human immortalized microglia. (B) Venn diagrams for hits from each viral pool in 8hr and 24hr treatments. (C) Overlapping hits from each viral pool with number of gRNAs identified in 8hr and 24hr treatment with SEC24B and ACSL4 highlighted. (D) qRT-PCR analysis showing markedly reduce expression of SEC24B in KO line (n=3). Unpaired t test. *p<0.05. Error bars represent SEM. (E) Western blot showing absence of SEC24B protein in KO line. (F) Death kinetics in SEC24B KO Hap1 cell line and isogenic control (n=3). AUC, one-way ANOVA, Dunnett post hoc. ****p<0.0001. Error bars represent SEM.
Article Snippet: The sgRNA sequences were amplified using Guide-it™ CRISPR Genome-Wide
Techniques: Selection, Genome Wide, CRISPR, Expressing, Quantitative RT-PCR, Western Blot
Journal: eLife
Article Title: An engineered biosensor enables dynamic aspartate measurements in living cells
doi: 10.7554/eLife.90024
Figure Lengend Snippet: CRISPR guides.
Article Snippet: Sequence-based reagent , GOT1_1 ,
Techniques: CRISPR, Sequencing
Journal: eLife
Article Title: An engineered biosensor enables dynamic aspartate measurements in living cells
doi: 10.7554/eLife.90024
Figure Lengend Snippet:
Article Snippet: Sequence-based reagent , GOT1_1 ,
Techniques: Virus, Sequencing, CRISPR
Journal: Genes & Development
Article Title: A C9orf72–CARM1 axis regulates lipid metabolism under glucose starvation-induced nutrient stress
doi: 10.1101/gad.315564.118
Figure Lengend Snippet: Loss of C9orf72 increases FA flux and biogenesis. ( A , B ) Wild-type and C9KO MEFs were starved with glucose-free medium for 16 h, and then the association of autophagy with LDs was monitored by immunostaining of BODIPY and lysosomal marker LAMP1. The number of BODIPY and LAMP1 double-positive puncta per cell was counted, and 30–40 cells in each group from three independent experiments were statistically analyzed. ( C ) Wild-type and C9KO MEFs were grown with or without glucose starvation for 16 h, and then LDs were isolated and subjected to SDS-PAGE and immunoblot against anti-LC3 and P62. ADRP served as a loading control. The ratios of LC3II/I and the amounts of P62 were calculated and statistically analyzed. n = 3. ( D – F ) Wild-type, C9KO, and C9/Atg5 double-knockout MEFs were starved with glucose-free medium for 16 h. The LDs were labeled with BODIPY and counted, and the association of autophagy and LDs was monitored as in A . Twenty-eight to 30 cells in each group from three independent experiments were statistically analyzed. ( G ) Wild-type and C9KO MEFs were cultured in CM or glucose-free medium with [1,2- 14 C] acetate at a final concentration of 0.3 µCi for 6 h. The incorporation of [1,2- 14 C] in total lipids was measured by a scintillation counter. Counts per minute (CPM) were normalized to the total amount of protein. n = 6. ( H – J ) Wild-type and C9KO MEFs were grown in glucose-free medium, and the protein levels of acetyl-CoA carboxylase (ACC) and NOX2 were determined at the indicated time points by immunoblotting. n = 3. (GS) Glucose starvation. Data are presented as mean ± SEM. (*) P < 0.05; (**) P < 0.01.
Article Snippet: The guide RNAs (gRNAs) for CRISPR–Cas9-mediated knockout of CARM1 or
Techniques: Immunostaining, Marker, Isolation, SDS Page, Western Blot, Control, Double Knockout, Labeling, Cell Culture, Concentration Assay