crispr guides Search Results


95
TaKaRa genome editing
Genome Editing, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/genome editing/product/TaKaRa
Average 95 stars, based on 1 article reviews
genome editing - by Bioz Stars, 2026-05
95/100 stars
  Buy from Supplier

92
Danaher Inc alt rtm crispr guide rnas
Alt Rtm Crispr Guide Rnas, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/alt rtm crispr guide rnas/product/Danaher Inc
Average 92 stars, based on 1 article reviews
alt rtm crispr guide rnas - by Bioz Stars, 2026-05
92/100 stars
  Buy from Supplier

93
TaKaRa crispr genome
Integrated <t>CRISPR‐Cas9</t> screening identifies key genes for tumor growth and cisplatin resistance in MTMCT. (A) Schematic overview of in vivo CRISPR‐Cas9 knockout screening. NOSCC1 cells transduced with the sgRNA library were divided into two groups—in vitro‐cultured reference cells and in vivo mouse tumors. (B) Scatter plot of negatively selected sgRNAs from in vivo tumors, showing fold‐change versus baseline gene expression (TPM) in NOSCC1. Red dots highlight the genes with TPM > 100. (C) Scatter plot of negatively selected sgRNAs from CDDP‐treated cells, showing fold‐change versus baseline gene expression (TPM) in NOSCC1. Red dots highlight the genes with TPM > 100. (D) Workflow for candidate gene prioritization and integration of transcriptomic and spatial transcriptomic data.
Crispr Genome, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/crispr genome/product/TaKaRa
Average 93 stars, based on 1 article reviews
crispr genome - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

94
TaKaRa crispr cas9 gesicle production system
Production and Characterization of <t>Cas9</t> Gesicles
Crispr Cas9 Gesicle Production System, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/crispr cas9 gesicle production system/product/TaKaRa
Average 94 stars, based on 1 article reviews
crispr cas9 gesicle production system - by Bioz Stars, 2026-05
94/100 stars
  Buy from Supplier

94
TaKaRa theguide itcrisprgenomewide sgrna library ngs analysis kit
Production and Characterization of <t>Cas9</t> Gesicles
Theguide Itcrisprgenomewide Sgrna Library Ngs Analysis Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/theguide itcrisprgenomewide sgrna library ngs analysis kit/product/TaKaRa
Average 94 stars, based on 1 article reviews
theguide itcrisprgenomewide sgrna library ngs analysis kit - by Bioz Stars, 2026-05
94/100 stars
  Buy from Supplier

93
TaKaRa library pcr kit
(A) Schema for positive selection <t>Genome-wide</t> <t>CRISPR</t> screen in Cas9-expressing human immortalized microglia. (B) Venn diagrams for hits from each viral pool in 8hr and 24hr treatments. (C) Overlapping hits from each viral pool with number of gRNAs identified in 8hr and 24hr treatment with SEC24B and ACSL4 highlighted. (D) <t>qRT-PCR</t> analysis showing markedly reduce expression of SEC24B in KO line (n=3). Unpaired t test. *p<0.05. Error bars represent SEM. (E) Western blot showing absence of SEC24B protein in KO line. (F) Death kinetics in SEC24B KO Hap1 cell line and isogenic control (n=3). AUC, one-way ANOVA, Dunnett post hoc. ****p<0.0001. Error bars represent SEM.
Library Pcr Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/library pcr kit/product/TaKaRa
Average 93 stars, based on 1 article reviews
library pcr kit - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

86
Addgene inc crispr guide
(A) Schema for positive selection <t>Genome-wide</t> <t>CRISPR</t> screen in Cas9-expressing human immortalized microglia. (B) Venn diagrams for hits from each viral pool in 8hr and 24hr treatments. (C) Overlapping hits from each viral pool with number of gRNAs identified in 8hr and 24hr treatment with SEC24B and ACSL4 highlighted. (D) <t>qRT-PCR</t> analysis showing markedly reduce expression of SEC24B in KO line (n=3). Unpaired t test. *p<0.05. Error bars represent SEM. (E) Western blot showing absence of SEC24B protein in KO line. (F) Death kinetics in SEC24B KO Hap1 cell line and isogenic control (n=3). AUC, one-way ANOVA, Dunnett post hoc. ****p<0.0001. Error bars represent SEM.
Crispr Guide, supplied by Addgene inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/crispr guide/product/Addgene inc
Average 86 stars, based on 1 article reviews
crispr guide - by Bioz Stars, 2026-05
86/100 stars
  Buy from Supplier

90
Benchling Inc crispr guide rna design tool
(A) Schema for positive selection <t>Genome-wide</t> <t>CRISPR</t> screen in Cas9-expressing human immortalized microglia. (B) Venn diagrams for hits from each viral pool in 8hr and 24hr treatments. (C) Overlapping hits from each viral pool with number of gRNAs identified in 8hr and 24hr treatment with SEC24B and ACSL4 highlighted. (D) <t>qRT-PCR</t> analysis showing markedly reduce expression of SEC24B in KO line (n=3). Unpaired t test. *p<0.05. Error bars represent SEM. (E) Western blot showing absence of SEC24B protein in KO line. (F) Death kinetics in SEC24B KO Hap1 cell line and isogenic control (n=3). AUC, one-way ANOVA, Dunnett post hoc. ****p<0.0001. Error bars represent SEM.
Crispr Guide Rna Design Tool, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/crispr guide rna design tool/product/Benchling Inc
Average 90 stars, based on 1 article reviews
crispr guide rna design tool - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
Synthego Inc four different crispr guide rnas
(A) Schema for positive selection <t>Genome-wide</t> <t>CRISPR</t> screen in Cas9-expressing human immortalized microglia. (B) Venn diagrams for hits from each viral pool in 8hr and 24hr treatments. (C) Overlapping hits from each viral pool with number of gRNAs identified in 8hr and 24hr treatment with SEC24B and ACSL4 highlighted. (D) <t>qRT-PCR</t> analysis showing markedly reduce expression of SEC24B in KO line (n=3). Unpaired t test. *p<0.05. Error bars represent SEM. (E) Western blot showing absence of SEC24B protein in KO line. (F) Death kinetics in SEC24B KO Hap1 cell line and isogenic control (n=3). AUC, one-way ANOVA, Dunnett post hoc. ****p<0.0001. Error bars represent SEM.
Four Different Crispr Guide Rnas, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/four different crispr guide rnas/product/Synthego Inc
Average 90 stars, based on 1 article reviews
four different crispr guide rnas - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
GenScript corporation rnase1 crispr guide rna (target sequence: tgccaagggctcatgcacga)
(A) Schema for positive selection <t>Genome-wide</t> <t>CRISPR</t> screen in Cas9-expressing human immortalized microglia. (B) Venn diagrams for hits from each viral pool in 8hr and 24hr treatments. (C) Overlapping hits from each viral pool with number of gRNAs identified in 8hr and 24hr treatment with SEC24B and ACSL4 highlighted. (D) <t>qRT-PCR</t> analysis showing markedly reduce expression of SEC24B in KO line (n=3). Unpaired t test. *p<0.05. Error bars represent SEM. (E) Western blot showing absence of SEC24B protein in KO line. (F) Death kinetics in SEC24B KO Hap1 cell line and isogenic control (n=3). AUC, one-way ANOVA, Dunnett post hoc. ****p<0.0001. Error bars represent SEM.
Rnase1 Crispr Guide Rna (Target Sequence: Tgccaagggctcatgcacga), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rnase1 crispr guide rna (target sequence: tgccaagggctcatgcacga)/product/GenScript corporation
Average 90 stars, based on 1 article reviews
rnase1 crispr guide rna (target sequence: tgccaagggctcatgcacga) - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
Synthego Inc crispr guide cagucauccgugcgauaugc
CRISPR guides.
Crispr Guide Cagucauccgugcgauaugc, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/crispr guide cagucauccgugcgauaugc/product/Synthego Inc
Average 90 stars, based on 1 article reviews
crispr guide cagucauccgugcgauaugc - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
Benchling Inc guide rnas for crispr–cas9-mediated knockout of carm1 or atg5
Loss of C9orf72 increases FA flux and biogenesis. ( A , B ) Wild-type and C9KO MEFs were starved with glucose-free medium for 16 h, and then the association of autophagy with LDs was monitored by immunostaining of BODIPY and lysosomal marker LAMP1. The number of BODIPY and LAMP1 double-positive puncta per cell was counted, and 30–40 cells in each group from three independent experiments were statistically analyzed. ( C ) Wild-type and C9KO MEFs were grown with or without glucose starvation for 16 h, and then LDs were isolated and subjected to SDS-PAGE and immunoblot against anti-LC3 and P62. ADRP served as a loading control. The ratios of LC3II/I and the amounts of P62 were calculated and statistically analyzed. n = 3. ( D – F ) Wild-type, C9KO, and <t>C9/Atg5</t> double-knockout MEFs were starved with glucose-free medium for 16 h. The LDs were labeled with BODIPY and counted, and the association of autophagy and LDs was monitored as in A . Twenty-eight to 30 cells in each group from three independent experiments were statistically analyzed. ( G ) Wild-type and C9KO MEFs were cultured in CM or glucose-free medium with [1,2- 14 C] acetate at a final concentration of 0.3 µCi for 6 h. The incorporation of [1,2- 14 C] in total lipids was measured by a scintillation counter. Counts per minute (CPM) were normalized to the total amount of protein. n = 6. ( H – J ) Wild-type and C9KO MEFs were grown in glucose-free medium, and the protein levels of acetyl-CoA carboxylase (ACC) and NOX2 were determined at the indicated time points by immunoblotting. n = 3. (GS) Glucose starvation. Data are presented as mean ± SEM. (*) P < 0.05; (**) P < 0.01.
Guide Rnas For Crispr–Cas9 Mediated Knockout Of Carm1 Or Atg5, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/guide rnas for crispr–cas9-mediated knockout of carm1 or atg5/product/Benchling Inc
Average 90 stars, based on 1 article reviews
guide rnas for crispr–cas9-mediated knockout of carm1 or atg5 - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

Image Search Results


Integrated CRISPR‐Cas9 screening identifies key genes for tumor growth and cisplatin resistance in MTMCT. (A) Schematic overview of in vivo CRISPR‐Cas9 knockout screening. NOSCC1 cells transduced with the sgRNA library were divided into two groups—in vitro‐cultured reference cells and in vivo mouse tumors. (B) Scatter plot of negatively selected sgRNAs from in vivo tumors, showing fold‐change versus baseline gene expression (TPM) in NOSCC1. Red dots highlight the genes with TPM > 100. (C) Scatter plot of negatively selected sgRNAs from CDDP‐treated cells, showing fold‐change versus baseline gene expression (TPM) in NOSCC1. Red dots highlight the genes with TPM > 100. (D) Workflow for candidate gene prioritization and integration of transcriptomic and spatial transcriptomic data.

Journal: Cancer Science

Article Title: In‐Tumor CRISPR ‐Cas9 Knockout Screening and Novel Therapy Development for Malignant Transformation of Ovarian Teratoma

doi: 10.1111/cas.70315

Figure Lengend Snippet: Integrated CRISPR‐Cas9 screening identifies key genes for tumor growth and cisplatin resistance in MTMCT. (A) Schematic overview of in vivo CRISPR‐Cas9 knockout screening. NOSCC1 cells transduced with the sgRNA library were divided into two groups—in vitro‐cultured reference cells and in vivo mouse tumors. (B) Scatter plot of negatively selected sgRNAs from in vivo tumors, showing fold‐change versus baseline gene expression (TPM) in NOSCC1. Red dots highlight the genes with TPM > 100. (C) Scatter plot of negatively selected sgRNAs from CDDP‐treated cells, showing fold‐change versus baseline gene expression (TPM) in NOSCC1. Red dots highlight the genes with TPM > 100. (D) Workflow for candidate gene prioritization and integration of transcriptomic and spatial transcriptomic data.

Article Snippet: Genome editing was performed using the Guide‐it CRISPR Genome‐Wide sgRNA Library System (Takara Bio, Japan), following the manufacturer's protocol.

Techniques: CRISPR, In Vivo, Knock-Out, Transduction, In Vitro, Cell Culture, Gene Expression

Production and Characterization of Cas9 Gesicles

Journal: Molecular Therapy

Article Title: Gesicle-Mediated Delivery of CRISPR/Cas9 Ribonucleoprotein Complex for Inactivating the HIV Provirus

doi: 10.1016/j.ymthe.2018.10.002

Figure Lengend Snippet: Production and Characterization of Cas9 Gesicles

Article Snippet: Unless otherwise noted, gesicles were prepared using the Guide-it CRISPR/Cas9 Gesicle Production System (catalog [Cat.] no. 631613; Clontech/Takara, Mountain View, CA, USA) according to the manufacturer’s instructions.

Techniques:

Assaying Gesicle Size and Concentration

Journal: Molecular Therapy

Article Title: Gesicle-Mediated Delivery of CRISPR/Cas9 Ribonucleoprotein Complex for Inactivating the HIV Provirus

doi: 10.1016/j.ymthe.2018.10.002

Figure Lengend Snippet: Assaying Gesicle Size and Concentration

Article Snippet: Unless otherwise noted, gesicles were prepared using the Guide-it CRISPR/Cas9 Gesicle Production System (catalog [Cat.] no. 631613; Clontech/Takara, Mountain View, CA, USA) according to the manufacturer’s instructions.

Techniques: Concentration Assay

Gesicle Treatment Rapidly Delivers Protein to CHME-5 Microglia

Journal: Molecular Therapy

Article Title: Gesicle-Mediated Delivery of CRISPR/Cas9 Ribonucleoprotein Complex for Inactivating the HIV Provirus

doi: 10.1016/j.ymthe.2018.10.002

Figure Lengend Snippet: Gesicle Treatment Rapidly Delivers Protein to CHME-5 Microglia

Article Snippet: Unless otherwise noted, gesicles were prepared using the Guide-it CRISPR/Cas9 Gesicle Production System (catalog [Cat.] no. 631613; Clontech/Takara, Mountain View, CA, USA) according to the manufacturer’s instructions.

Techniques:

Schematic of the HIV Long Terminal Repeat and Expected Products after CRISPR/Cas9 Targeting by Gesicles

Journal: Molecular Therapy

Article Title: Gesicle-Mediated Delivery of CRISPR/Cas9 Ribonucleoprotein Complex for Inactivating the HIV Provirus

doi: 10.1016/j.ymthe.2018.10.002

Figure Lengend Snippet: Schematic of the HIV Long Terminal Repeat and Expected Products after CRISPR/Cas9 Targeting by Gesicles

Article Snippet: Unless otherwise noted, gesicles were prepared using the Guide-it CRISPR/Cas9 Gesicle Production System (catalog [Cat.] no. 631613; Clontech/Takara, Mountain View, CA, USA) according to the manufacturer’s instructions.

Techniques: CRISPR

Gesicle Treatment Causes Specific Mutation Events at the HIV LTR

Journal: Molecular Therapy

Article Title: Gesicle-Mediated Delivery of CRISPR/Cas9 Ribonucleoprotein Complex for Inactivating the HIV Provirus

doi: 10.1016/j.ymthe.2018.10.002

Figure Lengend Snippet: Gesicle Treatment Causes Specific Mutation Events at the HIV LTR

Article Snippet: Unless otherwise noted, gesicles were prepared using the Guide-it CRISPR/Cas9 Gesicle Production System (catalog [Cat.] no. 631613; Clontech/Takara, Mountain View, CA, USA) according to the manufacturer’s instructions.

Techniques: Mutagenesis

Gesicle Treatment Reduces HIV Proviral Activity

Journal: Molecular Therapy

Article Title: Gesicle-Mediated Delivery of CRISPR/Cas9 Ribonucleoprotein Complex for Inactivating the HIV Provirus

doi: 10.1016/j.ymthe.2018.10.002

Figure Lengend Snippet: Gesicle Treatment Reduces HIV Proviral Activity

Article Snippet: Unless otherwise noted, gesicles were prepared using the Guide-it CRISPR/Cas9 Gesicle Production System (catalog [Cat.] no. 631613; Clontech/Takara, Mountain View, CA, USA) according to the manufacturer’s instructions.

Techniques: Activity Assay

Gesicle Dosage and Viability

Journal: Molecular Therapy

Article Title: Gesicle-Mediated Delivery of CRISPR/Cas9 Ribonucleoprotein Complex for Inactivating the HIV Provirus

doi: 10.1016/j.ymthe.2018.10.002

Figure Lengend Snippet: Gesicle Dosage and Viability

Article Snippet: Unless otherwise noted, gesicles were prepared using the Guide-it CRISPR/Cas9 Gesicle Production System (catalog [Cat.] no. 631613; Clontech/Takara, Mountain View, CA, USA) according to the manufacturer’s instructions.

Techniques:

(A) Schema for positive selection Genome-wide CRISPR screen in Cas9-expressing human immortalized microglia. (B) Venn diagrams for hits from each viral pool in 8hr and 24hr treatments. (C) Overlapping hits from each viral pool with number of gRNAs identified in 8hr and 24hr treatment with SEC24B and ACSL4 highlighted. (D) qRT-PCR analysis showing markedly reduce expression of SEC24B in KO line (n=3). Unpaired t test. *p<0.05. Error bars represent SEM. (E) Western blot showing absence of SEC24B protein in KO line. (F) Death kinetics in SEC24B KO Hap1 cell line and isogenic control (n=3). AUC, one-way ANOVA, Dunnett post hoc. ****p<0.0001. Error bars represent SEM.

Journal: bioRxiv

Article Title: Microglia ferroptosis is prevalent in neurodegenerative disease and regulated by SEC24B

doi: 10.1101/2021.11.02.466996

Figure Lengend Snippet: (A) Schema for positive selection Genome-wide CRISPR screen in Cas9-expressing human immortalized microglia. (B) Venn diagrams for hits from each viral pool in 8hr and 24hr treatments. (C) Overlapping hits from each viral pool with number of gRNAs identified in 8hr and 24hr treatment with SEC24B and ACSL4 highlighted. (D) qRT-PCR analysis showing markedly reduce expression of SEC24B in KO line (n=3). Unpaired t test. *p<0.05. Error bars represent SEM. (E) Western blot showing absence of SEC24B protein in KO line. (F) Death kinetics in SEC24B KO Hap1 cell line and isogenic control (n=3). AUC, one-way ANOVA, Dunnett post hoc. ****p<0.0001. Error bars represent SEM.

Article Snippet: The sgRNA sequences were amplified using Guide-it™ CRISPR Genome-Wide Library PCR Kit (Takara, 632651) and subjected to the high-throughput amplicon sequencing on NextSeq500.

Techniques: Selection, Genome Wide, CRISPR, Expressing, Quantitative RT-PCR, Western Blot

CRISPR guides.

Journal: eLife

Article Title: An engineered biosensor enables dynamic aspartate measurements in living cells

doi: 10.7554/eLife.90024

Figure Lengend Snippet: CRISPR guides.

Article Snippet: Sequence-based reagent , GOT1_1 , Synthego , CRISPR guide , CAGUCAUCCGUGCGAUAUGC.

Techniques: CRISPR, Sequencing

Journal: eLife

Article Title: An engineered biosensor enables dynamic aspartate measurements in living cells

doi: 10.7554/eLife.90024

Figure Lengend Snippet:

Article Snippet: Sequence-based reagent , GOT1_1 , Synthego , CRISPR guide , CAGUCAUCCGUGCGAUAUGC.

Techniques: Virus, Sequencing, CRISPR

Loss of C9orf72 increases FA flux and biogenesis. ( A , B ) Wild-type and C9KO MEFs were starved with glucose-free medium for 16 h, and then the association of autophagy with LDs was monitored by immunostaining of BODIPY and lysosomal marker LAMP1. The number of BODIPY and LAMP1 double-positive puncta per cell was counted, and 30–40 cells in each group from three independent experiments were statistically analyzed. ( C ) Wild-type and C9KO MEFs were grown with or without glucose starvation for 16 h, and then LDs were isolated and subjected to SDS-PAGE and immunoblot against anti-LC3 and P62. ADRP served as a loading control. The ratios of LC3II/I and the amounts of P62 were calculated and statistically analyzed. n = 3. ( D – F ) Wild-type, C9KO, and C9/Atg5 double-knockout MEFs were starved with glucose-free medium for 16 h. The LDs were labeled with BODIPY and counted, and the association of autophagy and LDs was monitored as in A . Twenty-eight to 30 cells in each group from three independent experiments were statistically analyzed. ( G ) Wild-type and C9KO MEFs were cultured in CM or glucose-free medium with [1,2- 14 C] acetate at a final concentration of 0.3 µCi for 6 h. The incorporation of [1,2- 14 C] in total lipids was measured by a scintillation counter. Counts per minute (CPM) were normalized to the total amount of protein. n = 6. ( H – J ) Wild-type and C9KO MEFs were grown in glucose-free medium, and the protein levels of acetyl-CoA carboxylase (ACC) and NOX2 were determined at the indicated time points by immunoblotting. n = 3. (GS) Glucose starvation. Data are presented as mean ± SEM. (*) P < 0.05; (**) P < 0.01.

Journal: Genes & Development

Article Title: A C9orf72–CARM1 axis regulates lipid metabolism under glucose starvation-induced nutrient stress

doi: 10.1101/gad.315564.118

Figure Lengend Snippet: Loss of C9orf72 increases FA flux and biogenesis. ( A , B ) Wild-type and C9KO MEFs were starved with glucose-free medium for 16 h, and then the association of autophagy with LDs was monitored by immunostaining of BODIPY and lysosomal marker LAMP1. The number of BODIPY and LAMP1 double-positive puncta per cell was counted, and 30–40 cells in each group from three independent experiments were statistically analyzed. ( C ) Wild-type and C9KO MEFs were grown with or without glucose starvation for 16 h, and then LDs were isolated and subjected to SDS-PAGE and immunoblot against anti-LC3 and P62. ADRP served as a loading control. The ratios of LC3II/I and the amounts of P62 were calculated and statistically analyzed. n = 3. ( D – F ) Wild-type, C9KO, and C9/Atg5 double-knockout MEFs were starved with glucose-free medium for 16 h. The LDs were labeled with BODIPY and counted, and the association of autophagy and LDs was monitored as in A . Twenty-eight to 30 cells in each group from three independent experiments were statistically analyzed. ( G ) Wild-type and C9KO MEFs were cultured in CM or glucose-free medium with [1,2- 14 C] acetate at a final concentration of 0.3 µCi for 6 h. The incorporation of [1,2- 14 C] in total lipids was measured by a scintillation counter. Counts per minute (CPM) were normalized to the total amount of protein. n = 6. ( H – J ) Wild-type and C9KO MEFs were grown in glucose-free medium, and the protein levels of acetyl-CoA carboxylase (ACC) and NOX2 were determined at the indicated time points by immunoblotting. n = 3. (GS) Glucose starvation. Data are presented as mean ± SEM. (*) P < 0.05; (**) P < 0.01.

Article Snippet: The guide RNAs (gRNAs) for CRISPR–Cas9-mediated knockout of CARM1 or Atg5 were designed with Benchling as follows: CARM1 (oligo1: 5′-CACCGCTCACTATCGGCGACGCGAA-3′; oligo2: 5′-AAACTTCGCGTCGCCGATAGTGAGC-3′) and atg5 (oligo1: 5′-CACCGAAGAGTCAGCTATTTGACGT-3′; oligo2: 5′-AAACACGTCAAATAGCTGACTCTTC-3′).

Techniques: Immunostaining, Marker, Isolation, SDS Page, Western Blot, Control, Double Knockout, Labeling, Cell Culture, Concentration Assay